Current Protocols
○ Wiley
All preprints, ranked by how well they match Current Protocols's content profile, based on 13 papers previously published here. The average preprint has a 0.01% match score for this journal, so anything above that is already an above-average fit. Older preprints may already have been published elsewhere.
Crang, N.; Contreras, O.
Show abstract
Covaris g-TUBEs can be used to fragment DNA to pre-determined sizes based on the relative centrifugal force that they are run at. They are recommended for use while preparing Oxford Nanopore Technology libraries by the manufacturer. However, the volumes and DNA concentration typically used for ONT libraries are outside the range of the example data provided by Covaris. Here, we ran g-TUBEs at three different relative centrifugal forces and determined the effect on DNA fragmentation in the range 0.5 - 4 {micro}g. This dataset can be used to inform the effective fragmentation of DNA for creating Oxford Nanopore libraries of an optimal size.
Cremer, N.; Diehl, A.
Show abstract
For co-transformation of two plasmids, both have to possess different antibiotic selection markers. If that is not the case, normally the gene of interest (GOI) is subcloned into another vector. Here we introduce a fast and easy method to exchange the antibiotic resistance cassette (ARC) in only two PCR steps. Method SummaryTo shuttle the antibiotic resistance cassette (ARC) from one vector to another, one can amplify the ARC of interest and use the resulting PCR-product as a primer pair for the next amplification step. Simply remove parental DNA template by DpnI digestion, transform PCR product directly in E. coli cells, select transformants on an appropriate agar plate and isolate target vector by plasmid preparation.
Porter, D. F.; Garg, R. M.; Meyers, R. M.; Miao, W.; Ducoli, L.; Zarnegar, B. J.; Khavari, P. A.
Show abstract
The easyCLIP protocol describes a method for both normal CLIP library construction and the absolute quantification of RNA cross-linking rates, data which could be usefully combined to analyze RNA-protein interactions. Using these cross-linking metrics, significant interactions could be defined relative to a set of random non-RBPs. The original easyCLIP protocol did not use index reads, required custom sequencing primers, and did not have an easily reproducible analysis workflow. This short paper attempts to amend these deficiencies. It also includes some additional technical experiments and investigates the usage of alternative adapters. The results here are intended to allow more options to easily perform and analyze easyCLIP.
Cortot, M.; Stehlik, T.; Koch, A.; Schlemmer, T.
Show abstract
Efficient protein synthesis in eukaryotic cells typically requires a 5' cap structure on messenger RNAs (mRNAs). However, under stress conditions or in viral infection, translation can also occur independently of the cap via internal ribosomal entry sites (IRES). IRES elements are therefore key regulators of protein expression in both viral and cellular contexts. Here we describe a cell-free protocol to quantitatively assess IRES-mediated translation using wheat germ extract (WGE) and a firefly luciferase (FLuc) reporter. The protocol includes template preparation, RNA synthesis and luminescence measurement following in vitro translation in WGE. This method enables rapid and robust comparison of IRES activity under controlled conditions and can additionally be applied to evaluate mRNA modifications designed to enhance translation efficiency. Key featuresO_LIStringent in vitro workflow from DNA template preparation through RNA synthesis and protein synthesis to reporter readout, including quality controls. C_LIO_LIEvaluation of IRES-driven translation suitable for testing combinations of IRES and CDS. C_LIO_LItranslation analysis without radioactive labeling. C_LI Graphical overview O_FIG O_LINKSMALLFIG WIDTH=200 HEIGHT=89 SRC="FIGDIR/small/716985v1_ufig1.gif" ALT="Figure 1"> View larger version (24K): org.highwire.dtl.DTLVardef@417649org.highwire.dtl.DTLVardef@1bcd186org.highwire.dtl.DTLVardef@15fecb3org.highwire.dtl.DTLVardef@acdf8d_HPS_FORMAT_FIGEXP M_FIG C_FIG Graphical AbstractPipeline for the production and evaluation of IRES-firefly luciferase constructs using wheat germ extract. (1-4) Preparation: IRES-firefly luciferase constructs are amplified in E. coli and isolated from bacterial cells. Plasmids are linearized to prepare for in vitro transcription. (5-6) Transcript synthesis and verification: In vitro transcription is followed by electrophoretic validation to confirm integrity and correct molecular weight. (7-8) Translation and detection: Translation is executed in wheat germ extract and quantified by measuring reporter activity in a luminometer.
Parker, D. M.; Winkenbach, L. P.; Parker, A.; Boyson, S.; Osborne Nishimura, E.
Show abstract
Visualization of gene products in Caenorhabditis elegans has provided insights into the molecular and biological functions of many novel genes in their native contexts. Single-molecule Fluorescence In Situ Hybridization (smFISH) and Immunofluorescence (IF) visualize the abundance and localization of mRNAs and proteins, respectively, allowing researchers to elucidate the localization, dynamics, and functions of many genes. Here, we describe several improvements and optimizations to existing IF and smFISH approaches specifically for use in C. elegans embryos. We present 1) optimized fixation and permeabilization steps to preserve cellular morphology while maintaining probe and antibody accessibility, 2) a streamlined, in-tube approach that negates freeze-cracking, 3) the smiFISH (single molecule inexpensive FISH) adaptation that reduces cost, 4) an assessment of optimal anti-fade products, and 5) straightforward quantification and data analysis methods. Most importantly, published IF and smFISH protocols have predominantly been mutually exclusive, preventing exploration of relationships between an mRNA and a relevant protein in the same sample. Here, we present methods to combine IF and smFISH protocols in C. elegans embryos including an efficient method harnessing nanobodies. Finally, we discuss tricks and tips to help the reader optimize and troubleshoot individual steps in each protocol.
Ong, J. Y.
Show abstract
RNA interference (RNAi) is a useful technique for knocking down a protein of interest, allowing for the study of the function of a gene product. However, RNAi techniques are prone to off-target effects, such as non-specific knockdown of genes besides the protein of interest. An important control and companion to RNAi knockdown experiments is the rescue experiment, wherein gene function is restored by expression of an RNAi-resistant construct of the protein of interest. Generating an RNAi-resistant construct of the protein of interest involves generating silent mutations within the coding sequence of the protein so that the resulting amino acid product is the same, but the protein mRNA is no longer a target for the RNAi. Here, Synonymous Mutation Generator, a Python-based web tool that takes an input DNA coding sequence and outputs a synonymous DNA coding sequence that is RNAi-resistant, is described. This web tool should be a useful resource for researchers cloning RNAi-resistant constructs. Synonymous Mutation Generator is easy to use and can be found at jong2.pythonanywhere.com, and the source code is available on GitHub.
Lange, K. I.
Show abstract
CRISPR/Cas9 genome editing has become an important and routine method in C. elegans research to generate new mutants and endogenously tag genes. One complication of CRISPR experiments is that the efficiency of single-guide RNA sequences can vary dramatically. One solution to this problem is to create an intermediate entry strain using the efficient and well-characterised dpy-10 guide RNA sequence. This "d10 entry strain" can then be used to generate your knock-in of interest. However, the dpy-10 sequence is not always suitable when creating an entry strain. For example, if your gene of interest is closely linked to dpy-10 on LGII or if you want to use the dpy-10 as a co-CRISPR marker for the creation of the entry strain then you can not use the dpy-10 sequence. This publication reports a synthetic guide sequence, GCTATCAACTATCCATATCG, that is not present in the C. elegans genome and can be used to create entry strains. This guide sequence is demonstrated to be relatively robust with a knock-in efficiency that varies from 1-11%. While this is lower than the efficiency observed with d10 entry strains, it is still sufficient for most applications. This guide sequence can be added to the C. elegans CRISPR toolkit and is particularly useful for generating entry strains where the standard dpy-10 guide sequence is not suitable.
Rabe, B. A.; Cepko, C.
Show abstract
Gibson Isothermal Assembly has become a widespread cloning method, with a multitude of advantages over traditional cut-and-paste cloning. It allows for scarless assembly of multiple fragments simultaneously and has become widely used for molecular cloning. We have found that a simple change to the formulation of the reaction mix, the addition of a single-stranded DNA binding protein, can substantially improve both the accuracy and efficiency of assembly, especially as the number of fragments being assembled increases. In addition, when creating this Enhanced Gibson Isothermal Assembly reaction mix in-house with homemade DNA ligase, the cost of the reaction can be reduced to less than $10 per milliliter.
Bonath, F.
Show abstract
Phased primers are used during the first PCR of amplicon library preparation in order to increase the complexity of the library. This increased complexity leads to improved sequencing quality even when sequencing with a 2x300 paired-end setup. We can show that libraries prepared using a phased primer approach are complex enough to reduce the amount of PhiX added to the sequencing reaction to that of other, complex libraries.
Rangel, R.; Anderson, S.; DeIuliis, G.; Manning, E. E.; Ahangari, F.; Pandit, A.; Kaminski, N.; Marti-Munoz, J.
Show abstract
Precision-cut lung slices (PCLS) have emerged as a powerful tool for studying the biology of viable human lung tissue. However, the presence of agarose impurities compromises RNA yield and integrity during the extraction process. We tested whether using an alternative Plant kit RNA extraction method to wash agarose impurities or pre-dissolving agarose from PCLS implementing a dissolving buffer for routine RNA isolation in gel-electrophoresis would improve RNA quantity, quality, and integrity. Our results show that RNA quantity and integrity are highly compromised when using a conventional method of RNA extraction. The plant kit and dissolution of agarose increased the RNA quantity to 0.42{+/-}0.11 and 0.65{+/-}0.17 {micro}g/PCLS (measured by the Qubit) and integrity number to 6.60{+/-}0.59 and 9.13{+/-}0.39 (measured by the Bioanalyzer), respectively. The presence of impurities in conventional and Plant kit extractions misled to an overestimation of the RNA quantity and quality using the NanoDrop. The Plant kit and agarose dissolution showed a significant transcript integrity increase in GUSB (p<0.0001) and COL1A1 (p<0.05) expression, validating these methods over conventional extraction. We encourage laboratories applying PCLS experimentation to implement alternative methods to remove agarose impurities during RNA extraction, as well as to rely on sensitive quantitative techniques, such as the Qubit and Bioanalyzer, for RNA quantification and integrity measurements.
Ohira, M. J.; Rhind, N.
Show abstract
pomBseen is a image analysis pipeline for the quantitation of fission yeast micrographs containing a brightfield channel and up to two fluorescent channels. It accepts a wide range of image formats and produces a table with the number, size and total and nuclear fluorescent intensities of the cells in the image. Written in MATLAB, pomBseen is also available as a standalone application.
Sawtelle, S.; Narayan, L.; Ding, Y.; Kim, E.; Berhman, E. L.; Lillvis, J. L.; Kawase, T.; Stern, D. L.
Show abstract
BackgroundO_LIMany Drosophila species use acoustic communication during courtship and studies of these communication systems have provided insight into neurobiology, behavioral ecology, ethology, and evolution. C_LIO_LIRecording Drosophila courtship sounds and associated behavior is challenging, especially at high throughput, and previously designed devices are relatively expensive and complex to assemble. C_LI ResultsO_LIWe present construction plans for a modular system utilizing mostly off-the-shelf, relatively inexpensive components that provides simultaneous high-resolution audio and video recording of 96 isolated or paired Drosophila individuals. C_LIO_LIWe provide open-source control software to record audio and video. C_LIO_LIWe designed high intensity LED arrays that can be used to perform optogenetic activation and inactivation of labelled neurons. C_LIO_LIThe basic design can be modified to facilitate novel study designs or to record insects larger than Drosophila. C_LIO_LIFewer than 96 microphones can be used in the system if the full array is not required or to reduce costs. C_LI ImplicationsO_LIOur hardware design and software provide an improved platform for reliable and comparatively inexpensive high-throughput recording of Drosophila courtship acoustic and visual behavior and perhaps for recording acoustic signals of other small animals. C_LI
Paulissen, E.; Martin, B. L.
Show abstract
An effective method for tissue specific ablation in zebrafish is the nitroreductase/metronidazole system. Expressing bacterial nitroreductase (ntr) in the presence of nitroimidazole compounds causes apoptotic cell death, which can be useful for understanding many biological processes. However, this requires tissue specific expression of the ntr enzyme, and many tissues have yet to be targeted with transgenic lines that express ntr. We generated a transgenic zebrafish line expressing ntr in differentiated skeletal muscle. Treatment of embryos with metronidazole caused muscle specific cell ablation. We demonstrate this line can be used to monitor muscle regeneration in whole embryos and in transplanted transgenic cells. Summary statement
Milavetz, B.; Haugen, J.; Rowbotham, K.
Show abstract
The location of nucleosomes in chromatin significantly impacts many biological processes including DNA replication, repair and gene expression. A number of techniques have been developed for mapping nucleosome locations in chromatin including MN-Seq (micrococcal nuclease digestion followed by next generation sequencing), ATAC-Seq (Tagamet chromatin fragmentation followed by next generation sequencing), and ChIP-Seq (chromatin immunoprecipitation and fragmentation followed by next generation sequencing). All of these techniques have been successfully used, but each with its own limitations. Recently, New England Biolabs has marketed a new kit, the NEBNext UltraII FS Library Prep kit, for preparing libraries for next generation sequencing from purified genomic DNA. This kit is based on a novel proprietary DNA fragmentation procedure which appears to cleave DNA that is not bound by proteins. Because DNA is fragmented directly in the FS kit, we tested whether the kit might also be useful for mapping the location of nucleosomes in chromatin. Using Simian Virus 40 (SV40) chromatin isolated at different times in an infection, we have compared nucleosome mapping using the NEB FS kit (FS-Seq) to MN-Seq, ATAC-Seq, and ChIP-Seq. Mapping nucleosomes using FS-Seq generated nucleosome profiles similar to those generated by ATAC-Seq and ChIP-Seq in regulatory regions of the SV40 genome. We conclude that FS-Seq is a simple, robust, cost-effective procedure for mapping nucleosomes in SV40 chromatin that should be useful for other forms of chromatin as well. We also present evidence that the FS kit may be useful for mapping the location of transcription factors in chromatin when sequencing reads between 75 and 99 base pairs in size are analyzed.
Udema, I.
Show abstract
BackgroundThere has been a concerted effort at establishing the best method for the measurement of initial rates for various purposes, including the calculation of kinetic parameters, the maximum velocity (Vmax), and the Michaelis-Menten constant (KM). ObjectivesThe objectives of this research are: 1) to derive equations without KM for the determination of the Vmax in particular and vice versa; 2) to determine the KM and Vmax with other equations other than the Michaelian equation; and 3) to subject the calculated and extrapolated kinetic parameters to pseudo- statistical remediation where necessary as a test of their viability and usefulness. MethodsThe study was experimental and theoretical. It is supported by the Bernfeld method of enzyme assay. ResultBy graphical means, the Vmax and KM values for galactosidase respectively range between 163 and 185 M/min and between 2.07 and 2.77 mg/L; the range by calculations is 177 and 214 M/min and 2.45 and 3.311 mg/L, subject to pseudo-statistical remediation. Overall, the ranges of Vmax and KM values for alpha-amylase from both the graphical method and calculation are, respectively, 1.095 to 1.018 mM/min and 18.15 to 20.554 g/L. ConclusionThe equations for the determination of the KM and Vmax, which are respectively invariant with respect to each other, were rederived. The initial rates must not be a mixture of both if the true KM and Vmax are of interest. The new pseudo-statistical method for the remediation of error in all measurements, if necessary, is viable, useful, and robust. Graphical abstract O_FIG O_LINKSMALLFIG WIDTH=200 HEIGHT=82 SRC="FIGDIR/small/537023v1_ufig1.gif" ALT="Figure 1"> View larger version (22K): org.highwire.dtl.DTLVardef@824dfaorg.highwire.dtl.DTLVardef@cd95e5org.highwire.dtl.DTLVardef@12c0771org.highwire.dtl.DTLVardef@19cb86d_HPS_FORMAT_FIGEXP M_FIG O_FLOATNOA:C_FLOATNO Plots where conditions that validate a very high incidence of rQSSA are the case: [ET] is >>[ST]. Plot of v1 to v5 versus [ST]1 to [ST]5 gave equation of linear regression (double reciprocal plot (drp)) such as: y = (0.08x - 0.0002) exp. (+3). A drp plot of all values of v versus all values of [ST] gave a linear regression equation such as: y = (0.08 x + 6 exp. (- 05)) exp. (+3). [Figure 1] stands for a linear regression of v versus [ST] (y = 0.0125x); [Figure 1] stands for a linear regression of 1/v versus 1/[ST]. [ST]nvn-1 - [ST]n-1vn is = zero in all data points. The reciprocal of the intercept gives a very high value (over estimation of the maximum velocity, Vmax (16667 mM/min) and consequently an over estimated Michaelis-Menten constant, KM (KM value is = 106.668 g/L)). C_FIG O_FIG O_LINKSMALLFIG WIDTH=200 HEIGHT=100 SRC="FIGDIR/small/537023v1_ufig2.gif" ALT="Figure 2"> View larger version (25K): org.highwire.dtl.DTLVardef@10020forg.highwire.dtl.DTLVardef@f75707org.highwire.dtl.DTLVardef@72c474org.highwire.dtl.DTLVardef@bfce2a_HPS_FORMAT_FIGEXP M_FIG O_FLOATNOB:C_FLOATNO Plots where conditions that neither totally validates an incidence of rQSSA nor sQSSA: Some v values are {propto} [ST] while some are not. Plot of all v values versus all [ST] values gave equation of linear regression (double reciprocal plot (drp)) such as: y = (0.6179 x + 0.1973) exp. (+3); the resulting Vmax is = 5.068mM/min and the KM is = 3.132g/L. The linear regression of 1/v versus 1/[ST] gave: y = (0.6682x - 0.0164) exp. (+3) for the plot covering 1/v1 to 1/v5. [Figure 2] stands for a "polynomial regression" of v versus [ST]; [Figure 2] stands for a linear regression of 1/v versus 1/[ST]. [ST]nvn-1 - [ST]n-1vn is = zero where the v values covers v7 to v14; [ST]nvn-1 - [ST]n-1vn is = zero where the v values covers v1 to v6. C_FIG O_FIG O_LINKSMALLFIG WIDTH=200 HEIGHT=99 SRC="FIGDIR/small/537023v1_ufig3.gif" ALT="Figure 3"> View larger version (24K): org.highwire.dtl.DTLVardef@7856f8org.highwire.dtl.DTLVardef@95ceb1org.highwire.dtl.DTLVardef@134ebb1org.highwire.dtl.DTLVardef@15de459_HPS_FORMAT_FIGEXP M_FIG O_FLOATNOC:C_FLOATNO Plots where conditions that validate an incidence of either rQSSA or sQSSA may be the case: Such conditions are [ST] {approx} [ET]; [ET] < KM. The Vmax value and KM value expected from the regression equation (y = 0.4495 x + 0.2921) exp. (+3) from the plot of 1/v versus 1/[ST] are respectively 3.423 mM/min and 1.54 g/L. [Figure 3] stands for either linear or "polynomial" regression of v versus [ST]: Both plot show R2 that is = 0.9996; [Figure 3] stands for a linear regression (drp) of 1/v versus 1/[ST]. C_FIG O_FIG O_LINKSMALLFIG WIDTH=200 HEIGHT=87 SRC="FIGDIR/small/537023v1_ufig4.gif" ALT="Figure 4"> View larger version (27K): org.highwire.dtl.DTLVardef@13aa340org.highwire.dtl.DTLVardef@b3c16eorg.highwire.dtl.DTLVardef@1604419org.highwire.dtl.DTLVardef@116dc95_HPS_FORMAT_FIGEXP M_FIG O_FLOATNOD:C_FLOATNO D: Plots where the condition that validate an incidence of sQSSA (or "Henri-Briggs-Haldane-Michaelis- Menten" (HBHMM) equation) may be the case: Such condition is that [ST] is >> [ET]. The Vmax value and KM value expected from the regression equation (y = 0.0449x + 0.0295) exp. (+6) from the plot of 1/v versus 1/[ST] are respectively 33.898 M/min and 1.522 g/L. [Figure 4] stands for a linear regression of 1/v versus 1/[ST]; [Figure 4] stands for a linear regression of v versus [ST]. C_FIG The summary presented in the graphical abstract is primarily intended to remind all and sundry, students and high-ranking scholars in the field, that the issue of QSSA must be reflected in the study of enzyme kinetics because the result of such a study has profound implications for scientific, engineering, and, in particular, medical applications. "To be as imposing as a titanic, does not mean that a titanic-like body is unsinkable". This implies that minor issues that are ignored can ultimately flaw a post-doctoral thesis by high-ranking researchers. Needless to give an example, but what needs to be taken home is that if an enzyme is very active with a given drug (and even food) to be activated, care should be taken to ensure that a low concentration of drug needs to be administered. In the management of diabetics, starchy foods containing resistant starches are recommended for the same reason.
Rihoux, A.; Gagne, A.; Mezreani, J.; Gonthier-Cummings, C.; Hamilton, L. K.; Samarut, E.; Tetreault, M.
Show abstract
BackgroundGenome editing in human skeletal muscle research requires protocols that maximize delivery while preserving viability and clonal outgrowth. We sought to develop a reagent-free workflow for CRISPR/Cas9 editing in human immortalized myoblasts and to demonstrate its performance in two use cases, an IARS1 knockout and an MLIP homozygous knock-in. MethodsWe optimized electroporation parameters using a green fluorescent protein reporter to compare three electrical settings for transfection and survival in E6/E7 myoblasts, then applied ribonucleoprotein delivery for editing. We evaluated the effect of confluency at electroporation, performed single-cell cloning without antibiotics or fluorescence-activated sorting, and validated edits by high-resolution melting pre-screen followed by Sanger sequencing. ResultsElectroporation optimization identified one parameter set that maximized delivery while preserving viability. Performing electroporation at low confluency increased clonal outgrowth and editing rates. The workflow yielded an 84% success rate for IARS1 knockout and a 3.3% success rate for MLIP homozygous knock-in. High-resolution melting provided a very sensitive pre-screen, detecting 96% to 100% of actual edits, reducing the number of Sanger sequencing needed. Performance was reproducible across runs and myoblast lines and increasing single-cell seeding scaled yields without compromising purity. ConclusionsThis work provides a practical and reproducible selection-free protocol that couples electroporation optimization, low confluency editing, single-cell cloning, and high-resolution melting sorting to generate pure edited myoblast lines. The approach is applicable to disease modeling in neuromuscular research and clarifies feasibility boundaries for essential genes and homology-directed repair in these cells.
Hildyard, J. C. W.; Wells, D. J.; Piercy, R. J.
Show abstract
Mammalian embryogenesis is an intricate, tightly orchestrated process. Progression from zygote through somitogenesis and on to organogenesis and maturity involves many interacting cell types and multiple differentiating cell lineages. Quantitative PCR analysis of gene expression in the developing embryo is a valuable tool for deciphering these interactions and tracing lineages, but normalisation of qPCR data to stably expressed reference genes is essential. Patterns of gene expression change globally and dramatically as embryonic development proceeds, rendering identification of appropriate reference genes challenging at both the whole embryo- and individual tissue-level. We have investigated expression stability in mouse embryos from mid to late gestation (E11.5-E18.5), both at the whole-embryo level, and within more restricted tissue domains (head, developing forelimb), using 15 candidate reference genes (ACTB, 18S, SDHA, GAPDH, HTATSF1, CDC40, RPL13A, CSNK2A2, AP3D1, HPRT1, CYC1, EIF4A, UBC, B2M and PAK1IP1), and four complementary algorithms (geNorm, Normfinder, Bestkeeper and deltaCt). Unexpectedly, all methods suggest that many genes within our candidate panel are acceptable references, and despite disagreement over highest-scoring candidates, AP3D1, RPL14A and PAK1IP1 are the strongest performing genes overall. Conversely, HPRT1 and B2M are consistently poor choices: these genes show strong developmental regulation. We further show that use of AP3D1, RPL13A and PAK1IP1 can reveal subtle patterns of developmental expression even in genes ostensibly ranked as acceptable (CDC40, HTATSF1), and thus these three represent universally suitable reference genes for the mouse embryo.
Li, Z.; Haydar, T. F.
Show abstract
Sample multiplexing is a common approach to reduce experimental cost and technical batch effect. Here, we present a protocol that for the first time allows the pooling of single nuclei from multiple biological samples prior to performing simultaneous single nuclei RNA-seq and ATAC-seq, which we term Multiplexed Multiome (MuMu). We describe steps for assembling the custom Tn5 transposome, performing the transposition reaction, nuclei pooling, sequencing library preparation, and sequencing data pre-processing. This protocol will greatly reduce the cost of sn-Multiome. Graphical abstract O_FIG O_LINKSMALLFIG WIDTH=163 HEIGHT=200 SRC="FIGDIR/small/625728v2_ufig1.gif" ALT="Figure 1"> View larger version (40K): org.highwire.dtl.DTLVardef@19d7962org.highwire.dtl.DTLVardef@18c1c04org.highwire.dtl.DTLVardef@18355a9org.highwire.dtl.DTLVardef@16cdb6f_HPS_FORMAT_FIGEXP M_FIG C_FIG
Hu, I.
Show abstract
The commercialisation of miniprep kits supplanted the original alkaline lysis method for plasmid DNA preparation, and had remained relatively unchanged for almost two decades. The Miraprep substantially improved the yields of miniprep kits. However, the method still relies on commercial kits, which can be a burden financially to certain projects. Additionally, Pronobis et al. also identified loss of RNAse activities in miniprep kits over time. The present novel plasmid DNA isolation protocol addresses the two issues mentioned above utilising alkaline lysis and alkaline hydrolysis principles. With a largely identical workflow and operation time, the Macerprep will significantly reduce costs of establishing new laboratories as well as maintenance of running molecular biology laboratories.
Lin, S.-P.; Lin, C.-N.; Wang, W.-R.; Tsai, C.-H.
Show abstract
Stable and productive CHO cell lines are essential for biopharmaceutical manufacturing, yet early expansion steps are often constrained by prolonged period required for suspension adaptation. Single-cell cloning (SCC) ensures monoclonality and regulatory compliance, but cells transitioning from static to suspension culture frequently exhibit variable recovery, which prolongs timelines and increases process variability. To address this challenge, mixing-based microplate culture systems have been developed to improve early expansion efficiency. The C.NEST platform provides controlled pneumatic mixing and environmental monitoring that facilitates earlier adaptation to suspension conditions. At the 96-well and 24-well stages, this system allows cells to establish stable growth under suspension-like environments, thereby shortening the adaptation period following transfer to shaking culture. In this study, we applied C.NEST to the SCC workflow for developing CHO-K1 stable cell lines. Integrating C.NESTs controlled mixing reduced adaptation time, enhanced the consistency of clone expansion, and improved the ability to identify high-yield clones. These findings highlight the potential of C.NEST to streamline cell line development workflows by accelerating early suspension adaptation and improving clone selection reliability. Graphical abstract O_FIG O_LINKSMALLFIG WIDTH=200 HEIGHT=165 SRC="FIGDIR/small/693844v1_ufig1.gif" ALT="Figure 1"> View larger version (40K): org.highwire.dtl.DTLVardef@ca76bforg.highwire.dtl.DTLVardef@3a3079org.highwire.dtl.DTLVardef@447e01org.highwire.dtl.DTLVardef@ac8d6f_HPS_FORMAT_FIGEXP M_FIG C_FIG C.NEST mixing shortens suspension adaptation, accelerates clone expansion, and enhances early-stage screening. HighlightO_LIThe C.NEST microplate agitation culture system accelerates early CHO-K1 cell line development. C_LIO_LIControlled pneumatic mixing improved oxygen transfer and medium homogeneity, promoting stable growth during early expansion. C_LIO_LIEarly mixing shortens suspension adaptation by approximately one week. C_LIO_LIMixing cultures enabled more accurate clone performance assessment, revealing high-producing outliers. C_LIO_LIC.NEST provides a scalable and reproducible solution for integrating mixing-based culture into single-cell cloning workflows. C_LI